drawthread
The stories and information posted here are artistic works of fiction and falsehood.
Only a fool would take anything posted here as fact.
Only a fool would take anything posted here as fact.
drawthread
Fucking anons.
>>684277569
I'm a drawfag and i make drawthreads with images that arent mine either. whats your point faggot
>>684277353
Nice
/r/ Moss hanging hanging upside-down like a bat, sleeping, and urinating in her sleep, and getting her body wet.
More refs can be found here. http://imgur.com/a/k6HGL
I'll do requests badly
>>684278201
Requesting you riding a pig
post the others didn't see them all.
>>684278557
Thank you
>>684278595
No problem friend
>>684278557
Draw yourself ridding a pupper
If you're taking requests:
Draw an antelope head buttig a jeep through a tree.
With you in it.
>>684278557
Requesting a guy kissing you
gimme them requests~~
>>684279207
pin please fuck me
>>684278753
here you go friend
>>684279071
I can try, it will most likely be awful though
>>684279207
Requesting you make breakfast.
Oh well, not the best but here's some Eggs in a dress getting rammed from behind for the guy who requested it..
>>684279249
bite the pillow baby
>>684279071
This is bad, and the fact that I can only draw with the eraser isn't helping me any.
>>684279880
im okay with this thanks
>>684279377
basic ass breakfast...
before i disapear into the night
heres a better version of the blackknight...thing
>>684279207
Draw yourself like the picc
>>684279295
Yes I love the doggo
>>684280001
But it's adorable. Thank you
>>684280106
Made with love, of course. Thank you
>>684279207
requesting pin trying to be a model
>>684280323
I'm glad you think so
>>684278063
You wish to be true. Faggot.
>>684279548
Pretty hot!
>>684279880
>that burrito dick
>not a wine bottle
continuity errors.
>>684280294
>
>>684280366
ofc
>>684280463
dunno what you mean
>tfw i keep falling off the damn cliff and getting shot..
this game..is kinda frustrating
>>684279207
Draw this with the face of an alligator.
>>684280704
>wine bottle cock
god how long has that been out of fashion? what are you like 70?
>>684280852
Speaking of Wine bottles, why not shove one up your ass hole?
>>684280954
s'hard to fit it tho
>>684282056
Draw Pin bending over and someone tripping into her by accident
>>684282544
gonna pass
>>684282840
May I request Pin with 2 bananas in her pussy?
>>684282840
Requesting a mouse wizard.
>>684282056
Need to push harder, Or try squatting on top of it and putting your weight on it.
>>684282840
Pin x Trinket?
Hoya, Magi here.
Anybody knows what program should I use to start animating? Kinda lost with everything and want to animate.
Requesting anyone having their oc dressed as a vault dweller
Pic not related
one request?
>>684284113
Goat suplex
>>684283884
Thank you
>>684283999
flash is fairly simple, opentoonz is also pretty good
>>684282840
Is it cool if we draw Pin lewds?
>>684284626
s'all good with me
I request Drac to show his ugly mug.
>>684284055
>
>>684284429
I'll try that, thanks!
>>684285794
Ahhhhhh I love your drawings so much, and mixed with Fallout it makes it yessssss
still takin requests btw
not interested in any of the ones ive already gotten
>>684287028
Try balancing on your head
>>684287028
can you draw pin dressed like this?
>>684287028
If Pin were an animal what kind of animal would she be?
>>684286366
horry shit anon you make me blush
and if you like my style mixed with fallout you can always drop a request!
ʳᵉᵉᵉᵉᵉᵉᵉᵉᵉᵉ⋅⋅
>>684287028
Pin taking some dank kush
>>684287223
shush
>>684287223
REEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
>>684287218
I would but idk I feel really bad when I ask for requests, I really really really like how you draw!! Ahhh fuck I feel really embarrassed
>>684287407
ᴵ'ᶫᶫ ʳᵉᵉᵉᵉᵉᵉᵉᵉ ᶦᶠ ᴵ ʷᵃᶰᶰᵃ ʳᵉᵉᵉᵉᵉᵉᵉ﹗
>>684287499
ˢᵉᵉ, ʸᵒᵘ ᵒᵛᵉʳᵈᶦᵈ ᶦᵗ ᵃᶰᵈ ᶰᵒʷ ʸᵒᵘ'ʳᵉ ᵈᵉᵃᵈ⋅
>>684279207
Did you do the teen one? Had to run for a bit.
>>684287960
I SHALL NEVER DIE, REEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
>>684278201
Please draw this.
>>684287953
you a cutie patoot. You shouldnt feel bad at all about requesting, after all, we're ASKING for it, so request without guilt <3
>>684287217
some kinda dumb rabbit
>>684287398
drugs are for dummies
>>684288081
nah
>>684288447
>not a sheep
darn...
>>684287960
What's with condition red?
>>684287960
calm down, boo
>>684288112
ᵁʳ ˢᵒ ᵐᵃᵈ⋅⋅⋅
>>684288706
It's called condition color.
>>684288624
Why have you not drawn your self as a goat yet ?
>>684288352
Awsjdihdidbdi okay I'm sorry for all that I'm really awk
Do you think you can draw Magi (is that your ocs name?) as an NCR member? Imsorryicantpostapictureidonthavegoodreception
Did Lowell make any more art
>>684288853
ᴵ ᵃᵐ ᶜᵃᶫᵐ⋅
>>684288650
Don't listen to Pin about Pin. She's dumb.
>>684289022
I want to rape you while you are in that position .
>>684289515
ok, if you say so
>>684289515
Groooooooope
>>684289516
fucking true...
>>684277353
Rate mine anon
>>684289515
i want to impregnate you with my seed
>>684289516
Awkward teen EHG with a box of tampons like "WTF? You wanna die, anon?"
>>684289974
Why would teen EHG have a box of tampons tho?
>>684289516
one part sheep, two parts cotton candy
>>684290069
cause he's a fuckin' pussy
>>684280831
Bump for this
>>684290069
That's the joke.
>>684290232
EHG is a pretty tough guy
>>684288262
Here you go anon
>>684289582
>>684289753
>>684289796
Anons, this is all a bit much..
>>684289785
Line works alittle iffy and you should be more carful with smudging the paper. Altogether looks good anon, keep it up. Proud of you
>>684290507
You love it, slut.
>>684290507
why are your images so small now?
>>684289758
Suck my dick
![2016-05-14_10.42.28[1].jpg](https://i.imgur.com/eVnJJd5.jpg "2016-05-14_10.42.28[1].jpg")
>>684289785
it's neat
>>684290507
>implying you wouldn't want to be impregnated by me
>>684289582
>>684289753
>>684289796
>this cringe
It's a drawing. You cannot have sex with a drawing.
>>684291323
you know what imagination is?
>>684291323
^^^^
>>684291494
>still inciting cringe
Stop being a creepoid. You're jerking off to a drawing a sweaty 300 lbs balding dude is drawing.
>>684291704
Well, gee whiz, you sure have changed my mind! Where would I be without you, Captain Obvious?
Requesting one of you kind draw friends to draw my super hero character from my M&M game.shes rather fit and wearing a mask like in said picture. with no cape/hood but the same outfit. and with a utility belt around her waist wearing black thigh high heels. shoulder length black hair with grey eyes and a tan complexion.
https://www.youtube.com/watch?v=d01XRSB-7dA
>>684290507
You look tired, go lay down you lil' green shite.
>>684291494
>imagination
People here have imaginations?? stop lying.
>>684289196
No problem at all! Yes, Magi's the name, and dont worry about the ref :D
Sorry about the delay btw!
>>684291704
>what is hentai?
>>684292183
requesting magi dressed as an atom cat
>>684292490
>atom cat
haven't played fallout 4 ;A; can you attach a ref?
atleast we still have peep
>>684290507
rape you with my seed while groping and frothing at the mouth
>>684292731
here you go, they usually wear aviators
>>684290666
Y-yes, Satan-sempai..
>>684290951
I wouldn't know, present you stats!
Mine are:
ACTGAGTTCCCTTAATTCGCCATTCCCGTTACACTCCGAATACGGTAATTGTTTAGTTTAGCTAAGCCTTAAGGCTGCTGAATGCACACGGTAGGTTACTGTTACCTTGAGTCACTTGAACTTAACACTGGAAGCTCTAAGCCTTAAGGCTGCTGAATGCACACGGTAGGTTACTGTTACCTTGAGTCACTTGAACTTAACACTGGAAGCTCCTAGGGCTAGGAATCGGATCGGAACTTCGAGGATCTCGGAGACCAGCTCTCGGGACACAGGATTCGAGGACCTGAGCTTTGCTCGGACGTGCGTAACGTACTAGGGCTAGGAATCGGATCGGAACTTCGAGGATCTCGGAGACCAGCTCTCGGGACACAGGATTCGAGGACCTGAGCTTTGCTCGGACGTGCGTAACGTATTAGGCGGCTATTAGGGACCAGTAACGTTGACCAGTTAGCTGGATAGCGCGTATTAGGACGGCTTCTCGGGATTAGAGGCTCTGCTGCTGGAGGATTAGGCGGCTAGCGGCTATTATTAACACAGTCGCTACCAGCTTCGACCA*deep inhale*
>>684292157
HAI!
>>684292998
Do you think one day I can caress her tail as we spoon?
if nigroid gets dubs he gets love
>>684293266
what a coincidenece mine are:
CCTGAGTTCCCTTAATTCGCCATTCCCGTTACACTCCGAATACGGTAATTGTTTAGTTTAGCTAAGCCTTAAGGCTGCTGAATGCACACGGTAGGTTACTGTTACCTTGAGTCACTTGAACTTAACACTGGAAGCTCTAAGCCTTAAGGCTGCTGAATGCACACGGTAGGTTACTGTTACCTTGAGTCACTTGAACTTAACACTGGAAGCTCCTAGGGCTAGGAATCGGATCGGAACTTCGAGGATCTCGGAGACCAGCTCTCGGGACACAGGATTCGAGGACCTGAGCTTTGCTCGGACGTGCGTAACGTACTAGGGCTAGGAATCGGATCGGAACTTCGAGGATCTCGGAGACCAGCTCTCGGGACACAGGATTCGAGGACCTGAGCTTTGCTCGGACGTGCGTAACGTATTAGGCGGCTATTAGGGACCAGTAACGTTGACCAGTTAGCTGGATAGCGCGTATTAGGACGGCTTCTCGGGATTAGAGGCTCTGCTGCTGGAGGATTAGGCGGCTAGCGGCTATTATTAACACAGTCGCTACCAGCTTCGACCT
>>684290601
Thank you very much anon this is noted
>>684293496
faggot, this is how you get dubs
>>684292183
F u c k I love how you draw his hair and thank you vvvv much for drawing it! That's all I'm going to request because I don't wanna bombard you with stuff and I gotta go for a little, bye!
-Kanny
>>684293496
poor nigroid
>>684293496
>>684292998
does peep have an art blog or something?
>>684293266
Tsk... showing your gene sequence for all to see. Scandalous. Do we need the belt again?
>>684293041
Will it be you or me frothing at the mouth?
>>684293606
GASP!
Recent studies show we have a very high HLA compatibility!
>>684293836
Game source?
>>684279880
for Pins
I'll never stop loving you regardless, thread.
>>684293913
anon, if you do, i swear to god i'll beat the shit out of you
>>684294101
Who are you again?
>>684293951
>Recent studies show we have a very high HLA compatibility!
is that good?
>>684293951
both :^)
>>684293665
Hey, no probs at all! loved drawing it. Thanks for the compliment, and make sure to come here often to request me something, your request was fun!
>>684293081
Thanks for the ref! Done!
>>684294339
Why would you need to know?~
https://www.youtube.com/watch?v=UkD_zK69p8E
>>684293266
Hello, don't lay here, the floor is disgusting, you don't know what the anons do here.
>>684293913
A-anon-sempai, you're home already? What kind of hours do you even work??
>>684294209
Yah, it was more cringey than I though it would be......
>>684294101
<3
>>684294528
sup Magi, what's new?
>>684294637
fuck off ;)
>>684294528
nice, thank you
>>684293836
watch these dubs faggot
>>684294664
Drawing a commish right now! What about you?
>>684294831
No probs!
>>684294637
Overnights. Was asleep, but got a call. Tsk... I see I need to keep a better eye on you.
>>684294060
yaaaaaaaaaas! <333333
i love this thank you!!
>>684294369
Idk bro, prolly won't matter as I doubt you'll be able to know me up, us being different species and all..
>>684294488
Now we're talking!
>>684294612
Y-you think it has semen on it?
>>684294736
I will, soon.
>>684294910
I see..
You could try one of those remote shock collars:3
>>684294909
i'm just being lazy, i'm going to start doing something when I wake up completely
Hey guys!
I can take /r/ today!
Eating home made fries atm, YUM!
Can someone redraw him?
>>684295341
set yourself on fire
>>684295142
no prob~
>>684295247
you never know unless you try
>>684295247
I have a decent job, but seems like you'd drain batteries quickly... Crating would be more efficient.
>>684295391
Away, Homecuck.
>>684295256
take your time
stretch that butt
and start to draw
Ey guys long time no see
Whatd I miss?
Taking /r/
>>684295811
Dress as frog girl from Hero Academia
>>684295567
It can be our science project~
>>684295635
U try putting me in a fucking crate.
>>684295811
QUINN! I miss you! Requesting you being hugged by a group drawfags and Anons.
>>684296192
stop blue
>>684296192
come on neggs, let's fuck, for science, if everything goes well we can be a happy family~
One and a half before I gotta do shit
Requests?
I would like someone to draw a cake eating a pie.
>>684295247
That and more, it's pretty gross to be honest, this is why you should never invite anons into your house.
>>684296385
Hour and a half*
>>684296192
Not giving me much choice here.
>>684296385
An alligator with a hat
>>684296385
Awfully handsome
>>684296510
don't put this possibly future parent in a crate, mate
>>684296335
k.
>>684296367
I don't even know you though...
>>684296452
H-have you had semen though..? I mean, it's totally gross.. but I guess it kinda.. grows on you..heh.
>>684296510
Bring it, bitch.
>>684295787
thx fam
>>684296385
fly
>>684297042
Woman, don't give me any lip.
>>684295811
Quinn! long time! How have you been? Feeling like drawing something frisky today?
>>684296525
>
She has a beautiful smile
>>684296725
Handsomely awful*
>>684297300
Ok
>>684295811
Lord it's been awhile
How are you?
>>684297274
You crying?
>>684296184
<3
>>684296205
HALLO! I missed you too <3
Any drawfags specifically?~ I dont know that many of them...
>>684297412
Yaaassss
Tryna get myself warmed up for a lewd commish :)
>>684297042
>H-have you had semen though..?
.... no comment.
>>684298033
:O Murph! I'm doing great!
How's life been?
Redraw my hell penguin pl0x
>>684298088
How about Murphy and Kahl?
>>684297408
I'm sorry for sperging, won't happen again..
>>684298110
They say it's good for your skin... your skin looks pretty good.
>>684298033
wlha
>>684298490
You're lucky you're cute...
>>684298088
Quinn you big ol' meganerd! Where you been?!
>>684298033
>>684298735
Thank you for pardoning me:3
>>684298490
you gonna be around for a bit?
/r/ loli butts
>>684298490
>>684298894
Haven't laughed that good in a while.
>>684298088
Nor OR, but saved!
Would you like to draw Alice trying to ride massive cock? prodding the tip hard making things squeeze and bulge?
References: http://sta.sh/21wm4aav89os
>>684299018
No, I probably should take this >>684299108
guy's clue and get going..
>>684298490
ˢʰᵘᵗ ᵘᵖ
Requesting massive beard guy with a fancy coat and a rifle
>>684298559
Sori I misinterpreted
>>684298466
Wowie that's an old one
>>684298204
I've been stretched a bit thin at the moment but that's nothing new
Been resting more
>>684298894
I'm dead
You have killed me
I can not breath
>>684297300
I'm ready chap
yo.
doin a request.
>>684298559
You need to kith someone with that tongue
>>684299628
goddammit...
well, i'll catch you some other time
>>684299961
anal
>>684290417
>comparing that monster to a sweetie like Quasimodo
u stop that anon
>taking requests btw
>>684300087
Give Quasimodo a hug.
>>684300056
Sure, and if you give up trying you can always reach me at drawersden.tumblr.com
>>684300087
You, arms thrown out, lokibg like a Mad Max extra as the thread burns behind you.
>>684298466
>sosorry
>forgot how Kahl's buffbod looked
>>684298762
Studying 24/7 'cause exams every week ;;
HOW HAVE YOU BEEN YOU CUTIE
>>684299039
someone do this
>>684299469
sure~
>>684299959
That's good <3 Some alone time is always great
Dont be too hard on yourself hun
>>684299961
HALLO!
>>684299961
Let's keep it slowly, lift up your shirt, shoving us underboob tese <3
Seductive eyes would be great.
>>684299959
thx fam!
>>684299961
become a god
>>684299762
On it, will be a nice training for me and I need loads of it
>>684300365
Noice. Thank you
>>684300277
gotcha. see you around
>>684300365
Yes ma'am
I wouldn't say too hard but I'll be fine in the end
>>684298981
Yeah, yeah...
>>684300365
>CUTIE
Stoppit you
But i've just been chilling and doing study stuff. It's good to have you back tho.
>>684300481
Thank you for the request
>>684299469
plop
>>684300511
Youre welcome <3
>>684300711
Good, good~
>>684301421
Aw sweetie :)
Did I miss any drama? Shit's so chill now
>>684302208
Thank you Quinn! you are bae <3
>>684300244
i can't believe this movie used to scare me as a kid irl, it's one of my favorites now
>>684302208
hot, gj
>>684299762
Better than nothing i guess :/10 mins~
>>684302510
can I get a draw of a frog who is a carpenter please
>>684302208
Quinn, welcome back
Whys the thread so dead?
>>684302433
>>684302770
Aw thanks cuties <3
>>684299961
Turbo autismo is back, jubilations.
Need warm up, give request
>>684302208
Eh, of course you did. It's all petty shit tho, I was in some recently but it's dumb.
When you're done with your requests can I grab one?
>>684303509
80's doggo dancer
>>684302924
Ayy, thanks anon <3
>>684303724
Need constructive criticism. Fuck me up fam
>>684303353
Quinn I forgot, you have your art gallery anywhere?
>>684303509
draw a hobo by a fire, petting a toaster?
>>684303509
a fish bone
>>684302208
Stop drawing for cancer.
>>684277353
This picture sucks so bad I can't even tell what it is.
Someone help me out
>>684300365
holy crap! its been ages!
how you been doing?
>>684300414
mabye a different time, mabye.
>>684300481
i am the lesser godless of electricity powered weapons.
Draw niggas on the moon
>>684304121
thanks skittles!
>>684300304
>
>>684303509
C..could you maybe draw a Bunny drewiling over a packet of Dextro Eenergy?
>>684303331
Heyyyy~ How's life been?
>>684303675
Noone is making any /r/ for me ; ;
Go right aheado <3
It's always some petty shit when it comes to /b/
>>684303931
Ahh no unfortunately
I was gonna make a tumblr but I got busy...
>>684304047
I wanted to draw lewds, and no one else had a request so :/
>>684304121
I've been great! You've gotten a lot better since I've been gone! How was laifu?
>>684304121
Aww I had hope for little bit of tease
>>684304645
Lifes been good, if you're interested in a request would you mind drawing Rukia doing something cute with a Yanma?
How about you? whatcha been up too?
>>684303675
>>684304645
Do not listen to haters, thanks again for lewd draw! And let's guess, all other people ramin vanilla. Wouldn't want to push my luck with another request in a row haha.
Also impressive, you got commissioned without official gallery!
>>684304858
hey doge
>>684304440
10/10, but no quads so
/d/ /e/ /n/ /i/ /e/ /d/
>>684305059
>quinn is girl
>better suck up as hard as possible
>she may love me then
>>684304645
I request your OC getting knotted by a werewolf.
>>684305321
>if I project harder it may become real!
>>684305321
>>684305516
>If I greentext, surely it's not faggotry
>>684304645
Put on these sunglasses and pose with me like a Cool Kid(Pat. Pending)
>>684304858
Dance doggo, dance!
>>684303833
As a shit drawer myself, you do seem above average.. the gun could use work and the eyepatch seems out of place so I assume the left eye couldn't turn out well.
I'd fuck you up more but I can't really see any other way to without being a complete asshole, so britty gud job sir
>>684303833
you want me to redline that?
>>684303989
>
>>684305308
Hi anon
>>684305740
Dancing is for a fag
Did this one for a YouTube vid.
This is OC. His name is Sparkie. Do not steal.
>>684304645
Hit me in the face with dat ass fam
>>684304038
>>684303114
in progress shot
>>684305311
!!
cucked of my birthright
>>684306212
damn thats gay
>>684304842
Been watching and reading Bleach-- timeskip Zaraki is fucking HOT
Just been studying a lot. Grateful for the summer off, tho~
>>684305059
>>684305321
Yeeee Id rather not get involved in this
>>684305419
Sorry hun I dont do furry..
>>684305740
YASSS
I gotta raise my coolboi-a-meter
>>684306453
OH ITS YOU
butnobuttfor you
>>684304469
drewilling?
sorry but i don't know what that mean
What drawfag has improved the most since starting?
>>684306392
This is OC, His name is Anti-Sparkie. Do not steal.
>>684306212
I saw the vid for this on some cringe playlist. Yeah, it fits.
No I'm not linking to it.
Kill yourself faggot.
>>684306196
>anon
oh, ok
>>684306744
Depends on how far back you go, and if you count drawfags who have left the threads in pursuit of actually gitting gud
>>684306857
His fonts make me want to kill myself
>>684306196
10/10 Thanks a lot!
>>684307111
Same, those are some awful choices.
>>684306708
Yeah, Zaraki is blowin it up these days
Glad to have you back, the drama has been about the same as it was before
and thank you for the delivery
>>684306504
thanks bub
>>684306744
me, duh
>>684306708
Buttsex or bondage, or both?
>>684306951
Lx? Vik?
I can't see when people posting underanon...
>>684307155
No problem
